Detail of EST/Unigene TCNT51690 |
Acc. | TCNT51690 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; |
Length | 1045 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_NNT (5 ESTs); |
Sequence | GACAACTAACTTCTCTATTACTTCAGCCATCAAAAAACACTTCTTTCTCCTTATTAAACC |
EST members of Unigene | EB435687 EB438208 CV020986 EB447677 CV021181 EB427815 FG629956 EB436823 FG630774 FG136315 EB435086 EH615081 EB438386 CV021743 FG203174 FS380096 FG622188 FG136613 CV017340 CV015985 CV018111 CV020814 CV017915 FG627106 EH614729 CV019459 CV020037 CV019844 FG203080 EB430541 FS381806 FG187288 FG195057 DV162532 FS432703 DW000886 EB447427 FG192548 FS413656 DV998744 EB433487 FG622480 DV161915 EB447615 CV016289 DW001070 FG632469 FG199643 CV016301 FG180941 FG199738 FS373945 FG638598 DV998972 EB436990 CV019982 CV021140 CV018241 CV016113 FG135494 CV018624 EB427770 EB433500 FG138776 CV021693 EB435912 FG192638 CV020893 DV159556 CV016062 EB436736 FG193196 CV019924 CV017798 FG625503 EB429056 CV018567 FG626451 EB437314 CV017402 FS419539 CV018771 CV019739 EB433670 FS407762 FG626421 CV017434 DV162093 FG134736 EB434245 FG622516 FG193907 FS424039 FG624329 CV019358 FG623458 FS420518 CV019521 FS433075 FS408364 FS387020 EB438069 EB437469 CV017752 EB682637 FS422191 FG625458 DV999047 EB448687 FG621668 CV018318 FG181026 EB438245 EB434551 DV998871 FG624439 CV016235 CV016427 CV021447 EB427887 FG134885 EB427885 CV017964 FG626480 EH614969 CV021627 EH614966 FG193815 FG187383 CV021634 CV018542 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |