| Detail of EST/Unigene TCSL75303 |
| Acc. | TCSL75303 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Petunia hybrida E-value=0; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Arabidopsis thaliana E-value=0; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Sinapis alba E-value=0; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic (Fragment) OS=Nicotiana tabacum E-value=0; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Antirrhinum majus E-value=0; |
| Length | 1348 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (21 ESTs); SRR015436 (14 ESTs); SL_MicroLEAF3 (12 ESTs); SL_maturing_fruit (10 ESTs); SL_Lyc_leaf (8 ESTs); LIBEST_024426 (3 ESTs); SL_flower_buds3 (2 ESTs); SL_FLOWERBUDS (2 ESTs); SL_CELL_BTI (2 ESTs); SL_CROWNGALL (2 ESTs); SL_SHOOT_4WEEK (1 ESTs); SL_flowerbuds4 (1 ESTs); SL_ROOT_pre-anthesis2 (1 ESTs); SL_pericarp (1 ESTs); SL_MicroFRUIT2 (1 ESTs); |
| Sequence | GATTAAAACGAACTCCATTTTCCTTCTCAGTTCACAAAAAAAAATCATGGGCAAGATTAA |
| EST members of Unigene | BE450246 DB679456 DB696181 DB686404 SRR015435.272826 BP901476 BP902441 BP904949 BP880439 SRR015435.332105 FS185088 SRR015435.51415 BP886447 SRR015436.322780 BP881034 BP878717 DB689450 SRR015435.13540 SRR015436.284002 BI924171 DB691374 BP890049 BP904730 DB688942 SRR015435.346301 SRR015436.231617 SRR015435.169508 SRR015436.326683 SRR015435.294171 SRR015435.147 DB704952 SRR015435.262757 BW689275 SRR015435.269923 SRR015435.300731 DB679661 SRR015436.109172 SRR015436.318754 SRR015435.263349 AW041622 BP904030 SRR015435.313374 SRR015435.201683 DB685384 SRR015435.194 CD002092 SRR015436.323297 BI926989 SRR015436.81379 SRR015435.313213 SRR015436.140390 BP910101 BE462872 DB695599 AW737257 SRR015436.146964 SRR015435.102485 BG127844 BP880168 FS205670 SRR015435.338602 SRR015436.246292 DB681390 BP898827 BG642415 BP875836 FS200988 SRR015435.75636 SRR015435.278394 BG135725 BG132457 DB704058 SRR015436.290294 SRR015436.190673 BP877227 BP907360 SRR015435.281256 BP886491 AW040975 BP888217 SRR015436.177069 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00134 glyceraldehyde 3-phosphate dehydrogenase |
| EC | 1.2.1.12 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819567 |
| Trichome-related Gene from Literature | 819567 |