Detail of EST/Unigene TCSL76486 |
Acc. | TCSL76486 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase OS=Hyoscyamus muticus E-value=0; Glutathione S-transferase APIC OS=Nicotiana tabacum E-value=1e-82; Glutathione S-transferase PARB OS=Nicotiana tabacum E-value=1e-81; Glutathione S-transferase F8, chloroplastic OS=Arabidopsis thaliana E-value=2e-70; Glutathione S-transferase F2 OS=Arabidopsis thaliana E-value=7e-65; |
Length | 1096 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015435 (21 ESTs); SL_maturing_fruit (21 ESTs); SL_breaker_fruit (10 ESTs); SL_MicroFRUIT2 (6 ESTs); SRR015436 (6 ESTs); SL_RES (5 ESTs); SL_FRUIT (5 ESTs); SL_cTOS (4 ESTs); SL_TAMU_CALLUS (3 ESTs); SL_CELL_BTI (3 ESTs); SL_flowerbuds4 (2 ESTs); SL_PRERIP_FRUIT_TAMU (2 ESTs); SL_radicle (2 ESTs); SL_CROWNGALL (2 ESTs); SL_SUS_LEAF (2 ESTs); SL_germ_seedlings_TAMU (2 ESTs); SL_DEF_ROOT (1 ESTs); SL_TAMU (1 ESTs); SL_GFRUIT (1 ESTs); SL_DROOT (1 ESTs); LIBEST_024426 (1 ESTs); SL_pericarp (1 ESTs); SL_flower_buds4 (1 ESTs); SL_ROOT (1 ESTs); SL_Lyc_leaf (1 ESTs); SL_flower_buds8 (1 ESTs); SL_MicroLEAF3 (1 ESTs); SL_SHOOT_4WEEK (1 ESTs); |
Sequence | GGCCATTACGGCCGGGGATTATTCCACGTTTTCTCACATCTCACACACAAATTTCATTTT |
EST members of Unigene | BP895704 AW649890 AW035305 BI927246 SRR015435.348006 SRR015435.333275 BM536439 BP882171 AW220064 SRR015435.263913 BP889495 SRR015436.260846 BG131843 BP876973 SRR015435.61120 BP876413 BG132446 AW039384 BW692315 BW688138 EG553299 AW735791 BP881423 BM408980 AW735788 AW041118 CD003386 BI205602 BI207122 BM410267 BI204033 AW218152 SRR015435.132870 BP875750 AW218151 SRR015435.195819 BF051895 BP879612 BE433869 BP885800 BE461931 BM413169 SRR015435.326315 BP877127 SRR015435.186453 AW932813 AI776914 BE461840 AI774583 BE434672 SRR015435.19806 SRR015436.131085 BI423026 SRR015435.240116 BP880568 BP895409 SRR015435.30161 BP879763 BW688601 BI204945 SRR015435.141053 AW930601 SRR015435.129253 BF112931 SRR015436.281602 BM413484 BP876675 DB697926 BP901787 AI773198 AI486597 BF112676 AI778462 SRR015435.261060 SRR015435.332954 SRR015435.124957 SRR015435.279476 BW690597 BP888456 AI772006 BM412133 BE432600 AI774099 BM413076 BW691140 SRR015435.118629 BP877207 BP877594 BM536301 SRR015435.227975 BG130474 BP894199 SRR015435.248929 BI423126 FS187934 BP887647 SRR015435.44753 SRR015436.109484 BW688582 AW040790 BF098093 SRR015436.37665 BP886493 SRR015436.331242 AW623451 AI781909 BP894798 AW648195 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819386 |
Trichome-related Gene from Literature | 819386 |