Detail of EST/Unigene TCMT40222 |
Acc. | TCMT40222 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Arabinogalactan peptide 16 OS=Arabidopsis thaliana E-value=2e-09; Arabinogalactan peptide 20 OS=Arabidopsis thaliana E-value=2e-08; |
Length | 639 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD (5 ESTs); MT_GSEED (4 ESTs); MT_GESD (3 ESTs); MT_DFLOWER (3 ESTs); MT_DROOT (2 ESTs); MT_JCVI-MT3 (2 ESTs); MT_NOD_GVN (2 ESTs); MTAMP (2 ESTs); MTFLOW (1 ESTs); MT_ECELL (1 ESTs); MT_DSLC (1 ESTs); MTPOSE (1 ESTs); MT_SROOT_KV1 (1 ESTs); |
Sequence | AACCATTTCTCTCTATCTCTGCGCGTCTTTTCTTCATTTCACACACAGAGAGAGAGACGC |
EST members of Unigene | AL377589 AL377588 AL377380 AL376264 AL376263 BE321024 BE320933 CX539474 CX536261 CX536161 BI268579 BG447831 BG581168 AW573971 BF006189 AJ504156 AJ503795 BI311178 BI310893 BI310816 BQ148361 BI273142 BI272964 AJ498679 BF004787 AJ497518 EY475994 EY474174 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.10565.1.S1_at
|
Corresponding NCBI Gene | 819241 |
Trichome-related Gene from Literature | N/A |