Detail of EST/Unigene TCMT40372 |
Acc. | TCMT40372 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=0; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=0; |
Length | 1173 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (22 ESTs); MT_VILEAF (15 ESTs); MT_DSLC (7 ESTs); MT_DLEAF (5 ESTs); MT_INSECT (3 ESTs); MT_Shoots (2 ESTs); MT_DSIL (1 ESTs); |
Sequence | ATGATTCGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCG |
EST members of Unigene | CX525116 CX524977 BF006673 BF006377 BF006069 BF005862 BF005636 BF005493 BF004887 AW683163 BE317897 AW683235 BE249402 BE249320 BF521328 BI264754 BI263989 BG457783 BG457389 BG457229 BG456994 BG456631 BG456466 BG456372 BG455345 BE323599 BE324960 BE323338 BF638939 BF638904 BF638815 BF638527 BF638390 BF637951 BF637895 BF637840 BF637611 CX523290 CX522785 CX522312 CX521975 CX521126 CX520966 CX520887 CX520200 CX519257 CX518802 CX518514 CX518511 CX518279 CX517665 CX516585 BI265050 BG449814 BE321654 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37221.1.S1_at
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |