| Detail of EST/Unigene TCMT41013 |
| Acc. | TCMT41013 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=0; Probable mannitol dehydrogenase OS=Mesembryanthemum crystallinum E-value=0; 8-hydroxygeraniol dehydrogenase OS=Catharanthus roseus E-value=0; Cinnamyl alcohol dehydrogenase 7 OS=Arabidopsis thaliana E-value=0; Cinnamyl alcohol dehydrogenase 8 OS=Arabidopsis thaliana E-value=0; |
| Length | 1444 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL (10 ESTs); MT_PhoLEAF (4 ESTs); MT_INSECT (4 ESTs); MT_VILEAF (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_Shoots (2 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_GPOD (1 ESTs); MT_CDS (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_DSTEM2 (1 ESTs); MT_JCVI-MT1 (1 ESTs); |
| Sequence | TGATNCGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
| EST members of Unigene | BT051572 CA918767 CX526602 CX524886 AW697220 EV254863 DW017235 CA917614 BF521442 BF520456 BF520453 BF519575 BE124289 BE123884 AW981344 AW981208 AW776649 AW776308 BE324445 BE325022 BF638191 BF638114 CX519139 CX518212 BI266731 BI265866 BF639755 BF639373 GE349253 GE344147 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 |
| EC | 1.1.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.37342.1.S1_at
|
| Corresponding NCBI Gene | 829954 |
| Trichome-related Gene from Literature | 829954 |