| Detail of EST/Unigene TCMT41077 |
| Acc. | TCMT41077 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable caffeoyl-CoA O-methyltransferase At4g26220 OS=Arabidopsis thaliana E-value=1e-71; Caffeoyl-CoA O-methyltransferase OS=Stellaria longipes E-value=1e-67; Caffeoyl-CoA O-methyltransferase OS=Mesembryanthemum crystallinum E-value=8e-67; Caffeoyl-CoA O-methyltransferase 6 OS=Nicotiana tabacum E-value=1e-66; Caffeoyl-CoA O-methyltransferase OS=Petroselinum crispum E-value=2e-66; |
| Length | 1146 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL (5 ESTs); MT_ECELL (5 ESTs); MT_LEAF_PHOMA (2 ESTs); MTUS_MIXTISSUE (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_PhoLEAF (1 ESTs); MT_HOGA (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_GSEED (1 ESTs); MT_NOD_GVN (1 ESTs); MT_UV-B (1 ESTs); MT_NOD_ROOT (1 ESTs); |
| Sequence | CTCATAATTAAGGTATGCAATATGCATGTATCTCTTAAGCATATTTTTCTACTAATGATC |
| EST members of Unigene | CF068083 CA918812 CX537110 BF650456 BF649235 BF646182 BF646063 BF645462 AW980337 DY632607 AW686370 BQ139680 BQ139156 BF519941 BF519859 BE124175 BE124003 AW776700 BG455746 CB893812 EY478434 GE349998 GE344992 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00545 catechol O-methyltransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00941 Flavonoid biosynthesis > K00588 caffeoyl-CoA O-methyltransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K00588 caffeoyl-CoA O-methyltransferase |
| EC | 2.1.1.104 2.1.1.6 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.40504.1.S1_at
|
| Corresponding NCBI Gene | 828728 |
| Trichome-related Gene from Literature | N/A |