| Detail of EST/Unigene TCMT41867 |
| Acc. | TCMT41867 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=0; |
| Length | 1131 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF (19 ESTs); MT_PhoLEAF (19 ESTs); MT_DLEAF (6 ESTs); MT_DFLOWER (4 ESTs); MT_INSECT (3 ESTs); MT_GESD (2 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_DSTEM2 (1 ESTs); MT_DSIL (1 ESTs); |
| Sequence | GAGGCAAAAATAAATAATCCTCCTCTTCATTTTCAATAGAACTACTCGTTTGTTTAACTT |
| EST members of Unigene | CA918775 AW694001 CA990484 BI312374 BQ147504 BI271408 BI271168 BI270612 AW682885 BE249542 BE316376 AW683140 BE317287 BF636882 BE124001 BI264918 BI264767 BI264621 BI264542 BI264268 BI264156 BI262994 BG457770 BG457600 BG457223 BG455913 BG455829 BG455442 BG455287 BG455152 BE324066 BE324825 BE324217 BF638741 CX523619 CX523371 CX523220 CX522345 CX521532 CX521240 CX520713 CX520612 CX520577 CX520489 CX519780 CX519736 CX518326 CX518109 CX518026 CX517672 CX517640 CX517244 CX517104 BG449344 BE322131 BF639930 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.50822.1.S1_at, Mtr.50822.1.S1_x_at
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |