Detail of EST/Unigene TCMT42668 |
Acc. | TCMT42668 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S27-2 OS=Arabidopsis thaliana E-value=2e-36; 40S ribosomal protein S27 OS=Hordeum vulgare E-value=3e-35; 40S ribosomal protein S27-1 OS=Arabidopsis thaliana E-value=5e-34; 40S ribosomal protein S27-3 OS=Arabidopsis thaliana E-value=6e-34; 40S ribosomal protein S27 OS=Chlamydomonas reinhardtii E-value=3e-30; |
Length | 506 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED (12 ESTs); MT_DFLOWER (5 ESTs); MtBB_NOD (3 ESTs); MT_SIRRA (3 ESTs); MT_Drought (3 ESTs); MT_DLEAF (2 ESTs); MT_DSIL (2 ESTs); MT_JCVI-MT1 (1 ESTs); MT_NOD_GVSN (1 ESTs); MHRP-root (1 ESTs); MT_CDS (1 ESTs); MT_JCVI-MT3 (1 ESTs); |
Sequence | GGTTCTGAATTTTTTAGGGTTTTTGCTTGAGTTGTCTCCTCTGTTTTCCGCTAACATGGT |
EST members of Unigene | BT051468 AL380047 AL378871 AL376442 CX542571 CX541362 CX540833 CX538440 CX537843 CX537092 CX536755 CX536479 CX536388 CX536357 CX536205 CX536096 EV258419 BE998073 BG588787 BQ148235 BQ147915 BI270722 BI270360 BI270114 BG452861 BE318806 BF518650 BE123993 BQ155093 BQ153423 BI269559 BG451387 BF635571 BF631771 EY474735 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02978 small subunit ribosomal protein S27e |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.35423.1.S1_at
|
Corresponding NCBI Gene | 825283 |
Trichome-related Gene from Literature | N/A |