Detail of EST/Unigene TCMT43553 |
Acc. | TCMT43553 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | UDP-glycosyltransferase 85A3 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 85A7 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 85A1 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 85A5 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 85A2 OS=Arabidopsis thaliana E-value=0; |
Length | 1693 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR (4 ESTs); MTUS_MIXTISSUE (3 ESTs); MT_ECELL (3 ESTs); MtBA (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_JCVI-MT1 (1 ESTs); MT_NOD_GVSN (1 ESTs); MT_NOD_GVN (1 ESTs); MT_CDS (1 ESTs); MT_NOD_NOLLY (1 ESTs); |
Sequence | GGGGGAAGACAAACTCACATAATTTGCAAGCACTTTACCATATTTCTTTCTTCTTTCACC |
EST members of Unigene | BT051987 DY617425 CF069162 CA920382 CA919726 BI262780 BF650303 BF643678 EV257134 BE999902 BG583183 CX535479 CX534790 CX532453 CX530795 AL367345 AL367344 GE349881 GE344848 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase |
EC | 2.4.1.17 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.38043.1.S1_at, Mtr.39322.1.S1_at
|
Corresponding NCBI Gene | 838845 |
Trichome-related Gene from Literature | N/A |