Detail of EST/Unigene TCMT43771 |
Acc. | TCMT43771 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Replication factor C subunit 2 OS=Rattus norvegicus E-value=0; Replication factor C subunit 2 OS=Mus musculus E-value=0; Replication factor C subunit 2 OS=Homo sapiens E-value=0; Replication factor C subunit 2 OS=Bos taurus E-value=0; Replication factor C subunit 2 OS=Gallus gallus E-value=0; |
Length | 1269 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT3 (2 ESTs); MT_VILEAF (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_SROOT_KV1 (1 ESTs); MT_Drought (1 ESTs); MT_INSECT (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_DROOT (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_GESD (1 ESTs); MT_DLEAF (1 ESTs); MT_PhoLEAF (1 ESTs); |
Sequence | CCTTAGAACTTAGAAACTCCCTCCAAGTTTGAAGCCAGTTCGCCATATAGGGTTTCGTTG |
EST members of Unigene | CF068757 BE319962 EV254992 BI311931 BG453337 BG455733 CX516659 CX535329 BF003560 BF635062 BI266102 EY477851 EY475200 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10755 replication factor C subunit 2/4 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.10966.1.S1_at
|
Corresponding NCBI Gene | 842620 |
Trichome-related Gene from Literature | N/A |