| Detail of EST/Unigene TCMT46566 |
| Acc. | TCMT46566 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase PARB OS=Nicotiana tabacum E-value=4e-74; Glutathione S-transferase OS=Hyoscyamus muticus E-value=6e-74; Glutathione S-transferase APIC OS=Nicotiana tabacum E-value=2e-73; Glutathione S-transferase F7 OS=Arabidopsis thaliana E-value=6e-69; Glutathione S-transferase F6 OS=Arabidopsis thaliana E-value=2e-68; |
| Length | 992 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA (8 ESTs); MT_JCVI-MT2 (6 ESTs); MtBC_GLOMUS (2 ESTs); MT_ECELL (2 ESTs); MT_JCVI-MT3 (1 ESTs); MT_NOD_ROOT (1 ESTs); MT_JAS_ROOR (1 ESTs); |
| Sequence | CAAAGTTAATTAAGAACAATAAATTAATCTTGTGATCGATTAATCTTGTAAATCATGGCA |
| EST members of Unigene | AL384561 AL384560 BF650493 BF647724 AW684286 CX531200 CB894955 CB894395 CB893807 CB893275 CB892937 CB065516 BG647450 BG646833 EY476771 GE351554 GE350770 GE349691 GE347108 GE345873 GE344640 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.40517.1.S1_s_at
|
| Corresponding NCBI Gene | 839295 |
| Trichome-related Gene from Literature | N/A |