| Detail of EST/Unigene TCMT49843 |
| Acc. | TCMT49843 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Putative proline--tRNA ligase C19C7.06 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=0; Bifunctional glutamate/proline--tRNA ligase OS=Mus musculus E-value=0; Proline--tRNA ligase OS=Plasmodium falciparum (isolate 3D7) E-value=0; Bifunctional glutamate/proline--tRNA ligase OS=Homo sapiens E-value=0; Bifunctional glutamate/proline--tRNA ligase OS=Drosophila melanogaster E-value=0; |
| Length | 1973 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED (4 ESTs); MT_JAS_ROOR (2 ESTs); MT_JCVI-MT1 (2 ESTs); MT_NOD_ROOT (1 ESTs); MT_ROOTPHOS (1 ESTs); MtSN4 (1 ESTs); MtBA (1 ESTs); MT_NOD_NOLLY (1 ESTs); MT_INSECT (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_TRI (1 ESTs); MT_DSTEM2 (1 ESTs); MT_ECELL (1 ESTs); |
| Sequence | CACGCTCCATCGCTCTCGCACGCTCCATTCTGTCTCGCCTTCTTTCCAACTCAACAAGGA |
| EST members of Unigene | DY617874 CA923108 CX540812 CX537394 CX536456 BI268700 AW694618 BF645128 EV258724 EV258512 AW683869 AW329489 AJ848720 CX533155 CX530544 AL366892 BI267587 ES613302 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01881 prolyl-tRNA synthetase; Genetic Information Processing > Translation > ko00970 Aminoacyl-tRNA biosynthesis > K01881 prolyl-tRNA synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01885 glutamyl-tRNA synthetase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K01885 glutamyl-tRNA synthetase; Genetic Information Processing > Translation > ko00970 Aminoacyl-tRNA biosynthesis > K01885 glutamyl-tRNA synthetase |
| EC | 6.1.1.15 6.1.1.17 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.43751.1.S1_at, Mtr.5703.1.S1_s_at
|
| Corresponding NCBI Gene | 825385 |
| Trichome-related Gene from Literature | N/A |