| Detail of EST/Unigene TCMT49884 |
| Acc. | TCMT49884 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase U17 OS=Arabidopsis thaliana E-value=1e-62; Glutathione S-transferase U18 OS=Arabidopsis thaliana E-value=3e-62; Glutathione S-transferase U16 OS=Arabidopsis thaliana E-value=1e-59; Glutathione S-transferase U15 OS=Arabidopsis thaliana E-value=9e-56; Glutathione S-transferase U13 OS=Arabidopsis thaliana E-value=2e-50; |
| Length | 982 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_FLOSEED_MTY (3 ESTs); MT_JCVI-MT2 (2 ESTs); MT_DSTEM2 (2 ESTs); MT_LEAF_PHOMA (2 ESTs); MT_DSIL (2 ESTs); MT_CDS (1 ESTs); MT_NOD_NOLLY (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_PhoLEAF (1 ESTs); MT_HOGA (1 ESTs); |
| Sequence | ACCGCAAATCTATTATCTCTCAACTACATATTCTTTCATATAACTTAAAAGGACTCCATA |
| EST members of Unigene | BT051592 DY617393 CA923160 AW693000 AW689535 EV254991 DW019262 DW015704 DW015076 BQ140801 BQ140785 BF520786 BF519757 BF639128 CB893410 GE351356 GE346871 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.10883.1.S1_at
|
| Corresponding NCBI Gene | 837576 |
| Trichome-related Gene from Literature | N/A |