Detail of EST/Unigene TCMT50014 |
Acc. | TCMT50014 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Succinate-semialdehyde dehydrogenase (acetylating) OS=Metallosphaera sedula (strain ATCC 51363 / DSM 5348) E-value=6e-77; S-(hydroxymethyl)glutathione dehydrogenase OS=Escherichia coli (strain UTI89 / UPEC) E-value=7e-47; S-(hydroxymethyl)glutathione dehydrogenase OS=Escherichia coli (strain K12) E-value=7e-47; S-(hydroxymethyl)glutathione dehydrogenase OS=Escherichia coli O6:K15:H31 (strain 536 / UPEC) E-value=7e-47; S-(hydroxymethyl)glutathione dehydrogenase OS=Escherichia coli O1:K1 / APEC E-value=7e-47; |
Length | 1567 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR (2 ESTs); MT_DSTEM2 (2 ESTs); MHRP-root (1 ESTs); MT_HOGA (1 ESTs); MT_MGHG (1 ESTs); MT_JCVI-MT3 (1 ESTs); MtBC_GLOMUS (1 ESTs); MT_ECELL (1 ESTs); MT_ROOTPHOS (1 ESTs); |
Sequence | GTCTTGATGCCACTTTGTTTCAATTTCAAAGATTGGATTGAATTGAATTGTCGTCTGTCT |
EST members of Unigene | AL385103 AW695809 AW696555 BF644476 AW126256 BG588407 CX532276 CX530565 BG646282 BE942398 EY473980 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 |
EC | 1.1.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.20505.1.S1_at
|
Corresponding NCBI Gene | 836482 |
Trichome-related Gene from Literature | N/A |