Detail of EST/Unigene TCMT52777 |
Acc. | TCMT52777 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA thiolase 2, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase 1, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase 5, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase, peroxisomal OS=Homo sapiens E-value=0; 3-ketoacyl-CoA thiolase A, peroxisomal OS=Mus musculus E-value=0; |
Length | 1632 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL (6 ESTs); MT_JAS_ROOR (6 ESTs); MT_INSECT (2 ESTs); MT_NOD_ROOT (2 ESTs); MtBA (2 ESTs); MT_DSTEM2 (1 ESTs); MT_ECELL (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MTAMP (1 ESTs); MT_DFLOWER (1 ESTs); MT_VILEAF (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_Drought (1 ESTs); |
Sequence | CTTGGGTGTGAAAGATGCCATCGCGTTTACTCAATTTTCTTAAAGTCAATCTCCACTTTC |
EST members of Unigene | AW560596 BE325104 BF644459 DW017576 BG448783 AW684703 AJ504179 BI271910 BG604179 BF520597 BF520357 BF520010 BF519691 AW775620 CX521803 CX534198 CX534045 CX533171 CX533123 CX531546 CX531038 AL369485 AL369484 BF635105 BF642006 BF639505 EY475057 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00362 Benzoate degradation via hydroxylation > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07513 acetyl-CoA acyltransferase 1; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K07513 acetyl-CoA acyltransferase 1 |
EC | 2.3.1.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.51464.1.S1_at
|
Corresponding NCBI Gene | 817876 |
Trichome-related Gene from Literature | 817876 |