Detail of EST/Unigene TCMT53448 |
Acc. | TCMT53448 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Replication factor A protein 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=2e-10; Replication protein A 70 kDa DNA-binding subunit OS=Xenopus laevis E-value=2e-07; Replication protein A 70 kDa DNA-binding subunit OS=Mus musculus E-value=4e-07; Replication protein A 70 kDa DNA-binding subunit OS=Homo sapiens E-value=1e-06; Replication protein A 70 kDa DNA-binding subunit OS=Drosophila melanogaster E-value=2e-06; |
Length | 843 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1 (4 ESTs); MtBA (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_Shoots (1 ESTs); MT_NOD_ROOT (1 ESTs); MT_DLEAF (1 ESTs); |
Sequence | GGAAGGAAAAATTGATAACCTTATTCACATTAGTTTTGGGATTCGCTACGTTGACTAAAT |
EST members of Unigene | CX525198 EV262496 EV262095 EV261419 EV259474 AW685488 BE316573 AL366817 EY476269 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K07466 replication factor A1; Genetic Information Processing > Replication and Repair > ko03440 Homologous recombination > K07466 replication factor A1; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K07466 replication factor A1; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K07466 replication factor A1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.9549.1.S1_a_at, Mtr.9549.1.S1_at
|
Corresponding NCBI Gene | 834576 |
Trichome-related Gene from Literature | N/A |