| Detail of EST/Unigene TCMT53511 |
| Acc. | TCMT53511 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase, mitochondrial OS=Arabidopsis thaliana E-value=0; Cysteine synthase, chloroplastic/chromoplastic OS=Solanum tuberosum E-value=0; Cysteine synthase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=0; Cysteine synthase, chloroplastic/chromoplastic OS=Spinacia oleracea E-value=0; Cysteine synthase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=0; |
| Length | 1136 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED (2 ESTs); MT_DSLC (1 ESTs); MT_DSIL (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_JAS_ROOR (1 ESTs); MtBA (1 ESTs); MT_JCVI-MT3 (1 ESTs); |
| Sequence | TTTTGTGATCCCATACCTAGTGTTTTGGTGGAACCTACTAGTGGGAACACAGGAATTGGT |
| EST members of Unigene | CX536289 BI268640 BF005475 AW776911 BE205084 CX533019 AL365539 EY478649 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01697 cystathionine beta-synthase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01697 cystathionine beta-synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01697 cystathionine beta-synthase; Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K01738 cysteine synthase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01738 cysteine synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01738 cysteine synthase |
| EC | 2.5.1.47 4.2.1.22 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.43518.1.S1_at, Mtr.49120.1.S1_s_at
|
| Corresponding NCBI Gene | 825145 |
| Trichome-related Gene from Literature | N/A |