| Detail of EST/Unigene TCMT56153 |
| Acc. | TCMT56153 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Endo-1,3;1,4-beta-D-glucanase OS=Zea mays E-value=1e-34; Carboxymethylenebutenolidase homolog OS=Mus musculus E-value=2e-21; Protein AIM2 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=3e-21; Carboxymethylenebutenolidase homolog OS=Xenopus tropicalis E-value=4e-20; Carboxymethylenebutenolidase homolog OS=Homo sapiens E-value=5e-20; |
| Length | 966 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2 (3 ESTs); MtBB_NOD (3 ESTs); MtBC_GLOMUS (2 ESTs); MT_IROOT_DSIR (1 ESTs); MHRP-root (1 ESTs); MT_SROOT_KV0 (1 ESTs); MtBA (1 ESTs); MT_Drought (1 ESTs); MT_TRI (1 ESTs); |
| Sequence | GTCAAACAAACAAAAATGTTAGGTCCGGCATGCTGCTCAAACCCACCAATTCTGAACTCT |
| EST members of Unigene | AL388209 AL388208 AL378514 AL377350 AL377349 AW560997 BE239632 BE204930 AL365872 BF634865 GE351168 GE346518 GE346517 EX527514 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00627 1,4-Dichlorobenzene degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00364 Fluorobenzoate degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K01061 carboxymethylenebutenolidase |
| EC | 3.1.-.- 3.1.1.45 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.27561.1.S1_s_at, Mtr.43127.1.S1_at
|
| Corresponding NCBI Gene | 821939 |
| Trichome-related Gene from Literature | N/A |