Detail of EST/Unigene TCMT56156 |
Acc. | TCMT56156 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase 3 OS=Glycine max E-value=1e-99; Probable glutathione S-transferase parC OS=Nicotiana tabacum E-value=3e-87; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=3e-87; Glutathione S-transferase U25 OS=Arabidopsis thaliana E-value=4e-81; Probable glutathione S-transferase parA OS=Nicotiana tabacum E-value=1e-80; |
Length | 988 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1 (3 ESTs); MT_DSIL (2 ESTs); MT_PhoLEAF (2 ESTs); MT_KVKC (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_CDS (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_Shoots (1 ESTs); MT_SIRRA (1 ESTs); MT_INSECT (1 ESTs); |
Sequence | TTTCTATATCATACAAATCTTATCCAAAAAATGGTCACACATTTTGTCAAAAAATATGAA |
EST members of Unigene | BT053411 CA922011 CX524279 EV261387 EV259893 EV259072 BE124057 AW776283 BF638519 BF638352 BQ156197 BQ165706 BQ165705 BF639411 GE349820 GE344779 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
Probeset |
Mtr.37762.1.S1_at
|
Corresponding NCBI Gene | 838289 |
Trichome-related Gene from Literature | N/A |