Detail of EST/Unigene TCMT57063 |
Acc. | TCMT57063 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Replication factor C subunit 4 OS=Homo sapiens E-value=1e-96; Replication factor C subunit 4 OS=Mus musculus E-value=2e-95; Probable replication factor C subunit 4 OS=Dictyostelium discoideum E-value=1e-92; Replication factor C subunit 2 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=4e-84; Replication factor C subunit 2 OS=Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173) E-value=1e-81; |
Length | 1188 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS (1 ESTs); MT_ECELL (1 ESTs); MT_JCVI-MT1 (1 ESTs); MTAMP (1 ESTs); MT_DLEAF (1 ESTs); MT_DSIL (1 ESTs); |
Sequence | GAGCAGAGAATCGTGTGTGAAGAGAAAATTACTAATATGGCGCCAATCATTCAGAGCACT |
EST members of Unigene | BT052457 BF646506 EV260699 AJ504119 BE317187 BF520452 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10755 replication factor C subunit 2/4 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.17295.1.S1_at
|
Corresponding NCBI Gene | 838771 |
Trichome-related Gene from Literature | N/A |