| Detail of EST/Unigene TCMT59082 |
| Acc. | TCMT59082 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 89A2 OS=Arabidopsis thaliana E-value=0; Cytochrome P450 89A9 OS=Arabidopsis thaliana E-value=0; Cytochrome P450 77A1 (Fragment) OS=Solanum melongena E-value=1e-84; Cytochrome P450 77A4 OS=Arabidopsis thaliana E-value=1e-81; Cytochrome P450 77A2 OS=Solanum melongena E-value=3e-80; |
| Length | 1930 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GPOD (13 ESTs); MT_CDS (2 ESTs); MT_Shoots (2 ESTs); MT_JCVI-MT1 (1 ESTs); MT_PhoLEAF (1 ESTs); MT_SROOT_KV1 (1 ESTs); MT_INSECT (1 ESTs); |
| Sequence | GGTTTTGTGTCACACACATAAATTCTTCCCCACAAAAGAGTAAAGTTGCACCAAACATTT |
| EST members of Unigene | BT053103 DQ335796 CX525107 CX523847 EV255138 CA918324 CA918184 CA918055 CA917991 CA916855 CA916810 BI308876 BI308717 BI308632 BI308590 BI308549 BI308239 BI307838 BE324783 BE203050 BF641819 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00513 cytochrome P450, family 21, subfamily A (steroid 21-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07422 cytochrome P450, family 2, subfamily U |
| EC | 1.14.14.1 1.14.99.10 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.16579.1.S1_x_at, Mtr.51059.1.S1_x_at
|
| Corresponding NCBI Gene | 842803 |
| Trichome-related Gene from Literature | N/A |