| Detail of EST/Unigene TCSL72203 |
| Acc. | TCSL72203 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=0; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=0; Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=0; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=0; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=0; |
| Length | 1533 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | LIBEST_024426 (16 ESTs); SL_MicroLEAF3 (6 ESTs); SRR015435 (5 ESTs); SL_TAMU_CALLUS (4 ESTs); SL_SHOOT_4WEEK (3 ESTs); SRR015436 (3 ESTs); SL_MicroFRUIT (2 ESTs); SL_ROOT_pre-anthesis2 (1 ESTs); SL_maturing_fruit (1 ESTs); SL_RIP_FRUIT_TAMU (1 ESTs); SL_FRUIT (1 ESTs); SL_SUS_LEAF (1 ESTs); |
| Sequence | CTCTTTCTTCTGCAGTCCAATCAAATGTCATGTCCAAAACGCTTTGCAAAGACCCCTCAT |
| EST members of Unigene | SRR015435.68875 SRR015436.57270 SRR015436.269886 AW651466 DB681680 FS205144 FS184900 SRR015436.245928 BE449692 SRR015436.333733 FS189215 FS194251 SRR015436.69176 BP880092 FS193656 BI921828 FS192811 DB721685 DB682446 AW034853 BP882890 BG643404 SRR015435.184141 FS194041 AI895594 DB712777 BG628074 FS183481 FS187131 BP897410 FS194905 AW222492 BG628779 AW033065 BE461875 BE432272 FS181200 FS200180 DB695922 FS193796 SRR015435.285080 SRR015436.292552 SRR015435.21585 SRR015436.50287 FS199916 SRR015435.35613 BP887278 FS199863 DB683992 BG124107 SRR015435.243299 DB704450 FS194780 AI896668 BM411536 BG125088 SRR015436.331028 AI778022 BM412510 SRR015435.207741 BE433026 DB700106 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828409 |
| Trichome-related Gene from Literature | 828409 |