| Detail of EST/Unigene TCMT40070 |
| Acc. | TCMT40070 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase subunit b', chloroplastic OS=Spinacia oleracea E-value=2e-63; ATP synthase subunit b', chloroplastic OS=Chlamydomonas reinhardtii E-value=4e-28; ATP synthase subunit b' OS=Thermosynechococcus elongatus (strain BP-1) E-value=1e-18; ATP synthase B' chain, cyanelle OS=Cyanophora paradoxa E-value=3e-18; ATP synthase subunit b' OS=Synechococcus sp. (strain PCC 6716) E-value=4e-18; |
| Length | 928 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF (15 ESTs); MT_INSECT (8 ESTs); MT_DSIL (6 ESTs); MT_SIRRA (4 ESTs); MT_Shoots (4 ESTs); MT_PhoLEAF (4 ESTs); MT_DSLC (2 ESTs); MTAMP (2 ESTs); MT_DLEAF (2 ESTs); MT_CDS (1 ESTs); MT_GSEED (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_JCVI-MT1 (1 ESTs); MTFLOW (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_LEAF_PHOMA (1 ESTs); |
| Sequence | GGTGTGGCAAAGAATTCAGATAGACCTCCTCCATTCCCAAATCCTCCTTCTCTCTCTCTA |
| EST members of Unigene | BT050682 CX536510 CX525616 CX524642 CX524395 CX523781 EV262420 DW016447 BF006255 BF005726 AJ502140 AJ501445 BQ139140 BG452507 BE316392 BF519739 BF519618 BF519484 BF519453 BF519354 AW776027 BI263416 BF638445 BF638148 BF638097 BQ156251 BQ154892 BQ154526 BI269165 CX523520 CX523293 CX522884 CX522850 CX522380 CX522058 CX521696 CX521034 CX519346 CX519198 CX519166 CX518385 CX517452 CX517207 CX516644 CX532146 AJ497601 BI268052 BI267195 BI267147 BI267117 BI265135 BG449266 BF641404 BF639677 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.2 H+- or Na+-translocating F-type, V-type and A-type ATPase superfamily F-ATPase |
| Probeset |
Mtr.20309.1.S1_at
|
| Corresponding NCBI Gene | 829359 |
| Trichome-related Gene from Literature | N/A |