| Detail of EST/Unigene TCMT40344 |
| Acc. | TCMT40344 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=3e-99; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=4e-99; Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=1e-98; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=2e-98; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=3e-98; |
| Length | 822 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF (31 ESTs); MT_PhoLEAF (8 ESTs); MT_DSIL (5 ESTs); MT_VILEAF (4 ESTs); MT_DSTEM2 (3 ESTs); MTPOSE (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_Shoots (1 ESTs); MT_DSLC (1 ESTs); |
| Sequence | CTGATTACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACC |
| EST members of Unigene | CF068373 CX527665 AW690497 BE325199 AW694112 BF005741 AW683280 BE315895 BE316088 AW683684 BE318041 BE316936 BE316294 AW683548 AW683750 BE317635 BE316463 AW683068 BE317015 BE316740 BE317048 BE316254 BE317939 BE316284 AW683417 AW683146 BE316865 BE317404 BE317676 BE315614 BE316787 BE316727 BF637020 BF636973 BF636954 BE316678 BE316575 BF521548 BF521261 BE124029 AW981330 AW776642 AJ498466 BI264914 BI264751 BI263152 BG458054 BG457098 BG455916 BE324245 BF638831 CX521632 CX519805 CX518209 CX517705 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |