Detail of EST/Unigene TCMT41373 |
Acc. | TCMT41373 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | unknown |
Length | 710 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA (4 ESTs); MT_JCVI-MT2 (4 ESTs); MT_PhoLEAF (2 ESTs); MT_MGHG (2 ESTs); MtBC_GLOMUS (2 ESTs); MT_JCVI-MT1 (2 ESTs); MHRP-root (1 ESTs); MT_DFLOWER (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_NOD_NOLLY (1 ESTs); MT_ECELL (1 ESTs); MTAMP (1 ESTs); |
Sequence | TGATACGCCAGCTCGAAATTAACCCTCCTAAAGGGAACAAAAGCTGGAGCTCCACCGCGG |
EST members of Unigene | DY618395 AL389162 AL389161 BQ135862 EV262499 EV260801 AJ502721 BE240212 BQ147077 BG456846 BG455496 BQ157040 BQ156943 BQ156017 BQ155667 BE942471 BE942420 EY476967 GE349668 GE347583 GE344614 GE343433 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.35810.1.S1_at
|
Corresponding NCBI Gene | 819266 |
Trichome-related Gene from Literature | N/A |