| Detail of EST/Unigene TCMT42672 |
| Acc. | TCMT42672 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S29 OS=Arabidopsis thaliana E-value=3e-27; 40S ribosomal protein S29 OS=Triticum aestivum E-value=2e-26; 40S ribosomal protein S29 OS=Griffithsia japonica E-value=5e-20; 40S ribosomal protein S29 OS=Ixodes scapularis E-value=9e-18; 40S ribosomal protein S29A OS=Guillardia theta E-value=1e-17; |
| Length | 420 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD (5 ESTs); MT_SIRRA (4 ESTs); MtBC_GLOMUS (4 ESTs); MT_GSEED (3 ESTs); MT_JCVI-MT3 (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_NOD_GVSN (2 ESTs); MT_MGHG (1 ESTs); MT_TRI (1 ESTs); MT_GESD (1 ESTs); MHRP-root (1 ESTs); MT_DFLOWER (1 ESTs); MT_PhoLEAF (1 ESTs); |
| Sequence | CCTACCACACAATTCTTCAGCTGTTTGCGCATTTGAGTCTCACCGGCGATCAAATCAATA |
| EST members of Unigene | AL388172 AL388171 AL384740 AL384739 AL381107 AL381106 AL381105 AL376542 AL376541 CX540823 CX539444 CX537736 BE999276 BE999275 BI312003 BE239561 BQ147163 BF638961 BQ157731 BQ152745 BQ152735 BQ152498 BE940895 EY475028 EY474967 GE348933 GE343778 ES613383 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02980 small subunit ribosomal protein S29e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.42862.1.S1_at
|
| Corresponding NCBI Gene | 829529 |
| Trichome-related Gene from Literature | N/A |