Detail of EST/Unigene TCMT46359 |
Acc. | TCMT46359 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Soyasaponin III rhamnosyltransferase OS=Glycine max E-value=0; Putative UDP-rhamnose:rhamnosyltransferase 1 OS=Fragaria ananassa E-value=0; UDP-glycosyltransferase 91A1 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 91C1 OS=Arabidopsis thaliana E-value=4e-92; UDP-glycosyltransferase 91B1 OS=Arabidopsis thaliana E-value=1e-91; |
Length | 1701 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA (6 ESTs); MT_JAS_ROOR (5 ESTs); MtBC_GLOMUS (2 ESTs); MtBB_NOD (2 ESTs); MHRP-root (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_TRI (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_ROOTPHOS (1 ESTs); |
Sequence | CGGCTATTCATACCTTCCAAATTACAAATCCAAGTCTTGATGGGTTCTACTGTTAATGAA |
EST members of Unigene | CA920942 AL385025 AL385024 AL380466 AL379418 AW559413 AW171728 BE239603 AW774149 BE203831 CX532472 CX532002 CX531596 CX530240 CX529647 AL373157 AL372947 AL372765 AL372039 AL369623 AL368731 ES613763 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase |
EC | 2.4.1.17 2.4.1.47 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37367.1.S1_at, Mtr.8530.1.S1_s_at
|
Corresponding NCBI Gene | 816790 |
Trichome-related Gene from Literature | N/A |