Detail of EST/Unigene TCMT46399 |
Acc. | TCMT46399 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Alcohol dehydrogenase 1 OS=Pisum sativum E-value=0; Alcohol dehydrogenase 1 OS=Trifolium repens E-value=0; Alcohol dehydrogenase OS=Malus domestica E-value=0; Alcohol dehydrogenase 1 OS=Petunia hybrida E-value=0; Alcohol dehydrogenase class-P OS=Arabidopsis thaliana E-value=0; |
Length | 1320 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_ROOT (6 ESTs); MT_JAS_ROOR (3 ESTs); MT_NOD_NOLLY (3 ESTs); MT_HOGA (2 ESTs); MT_DROOT (2 ESTs); MT_ECELL (2 ESTs); MTPOSE (1 ESTs); MT_JCVI-MT3 (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_Shoots (1 ESTs); MT_NOD_GVN (1 ESTs); MT_ROOTPHOS (1 ESTs); |
Sequence | AAACAATTCTCAATTGTTTCTTGCAATCTTCATCCGTTGCTTTTGTTAATTAACCATGTC |
EST members of Unigene | DY618088 DY617010 DY616821 CA920582 BE320517 BE320092 CX528558 BF650161 BF648311 BG583542 AW686645 AW684113 AW686466 AW685330 AW685268 AW684791 AW329540 AJ498404 CX533606 CX531053 CX530537 CB892717 BG648013 EY478484 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 |
EC | 1.1.1.1 1.1.1.284 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37443.1.S1_at, Mtr.37443.1.S1_x_at, Mtr.5041.1.S1_s_at
|
Corresponding NCBI Gene | 844047 |
Trichome-related Gene from Literature | N/A |