| Detail of EST/Unigene TCMT46543 |
| Acc. | TCMT46543 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Spermidine synthase 1 OS=Pisum sativum E-value=0; Spermidine synthase 2 OS=Pisum sativum E-value=0; Spermidine synthase OS=Coffea arabica E-value=0; Spermidine synthase OS=Solanum lycopersicum E-value=0; Spermidine synthase 1 OS=Datura stramonium E-value=0; |
| Length | 1379 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT3 (3 ESTs); MT_HOGA (2 ESTs); MtBA (2 ESTs); MT_ECELL (2 ESTs); MT_FLOSEED_MTY (2 ESTs); MT_SEEDROOT_KV3 (2 ESTs); MT_DLEAF (2 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_DSTEM2 (1 ESTs); MT_Drought (1 ESTs); MT_INSECT (1 ESTs); MTAMP (1 ESTs); MT_SROOT_KV2 (1 ESTs); MT_PhoLEAF (1 ESTs); MT_VILEAF (1 ESTs); |
| Sequence | GGACTTACACCCACACGAATCAAGTGACTTCCCTACTTCATTGCAAACCAAACCAAAACA |
| EST members of Unigene | CA919191 AW687935 BF647107 BF645487 DW018226 DW015696 AJ502776 CB892418 AW736244 BG452175 BE318715 AW256700 BF637598 CX517552 CB894353 CB892676 AL367694 AL367693 BG450410 BI266846 EY478881 EY476163 EY474402 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00797 spermidine synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00797 spermidine synthase |
| EC | 2.5.1.16 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.8786.1.S1_at
|
| Corresponding NCBI Gene | 838993 |
| Trichome-related Gene from Literature | N/A |