| Detail of EST/Unigene TCMT46637 |
| Acc. | TCMT46637 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Rac-like GTP-binding protein RHO1 OS=Pisum sativum E-value=1e-96; Rac-like GTP-binding protein RHO1 OS=Beta vulgaris E-value=6e-95; Rac-like GTP-binding protein ARAC1 OS=Arabidopsis thaliana E-value=8e-95; Rac-like GTP-binding protein ARAC6 OS=Arabidopsis thaliana E-value=1e-94; Rac-like GTP-binding protein ARAC11 OS=Arabidopsis thaliana E-value=1e-94; |
| Length | 1021 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | GLSD (3 ESTs); MT_CDS (2 ESTs); MHRP-root (2 ESTs); MT_INSECT (1 ESTs); MT_JCVI-MT2 (1 ESTs); MT_NOD_NOLLY (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_DLEAF (1 ESTs); MT_VILEAF (1 ESTs); MT_JAS_ROOR (1 ESTs); MtBA (1 ESTs); |
| Sequence | GACACTCTCATCTTCCAAATAGGTTCTTTCTCTTTCTTTCTTCGTTAATTGCCTTCTCAT |
| EST members of Unigene | BT051486 AF498359 DY615459 EV258596 BG588101 BE239539 BE316788 CA858510 CA858284 CA858140 CX518966 CX534420 AL368389 BF640323 GE350705 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 9.A.5 Peroxisomal protein importer PPI |
| Probeset |
Mtr.43489.1.S1_at
|
| Corresponding NCBI Gene | 816290 |
| Trichome-related Gene from Literature | 816290 |