| Detail of EST/Unigene TCMT46928 |
| Acc. | TCMT46928 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-hydroxyisobutyryl-CoA hydrolase 1 OS=Arabidopsis thaliana E-value=0; Probable 3-hydroxyisobutyryl-CoA hydrolase 3 OS=Arabidopsis thaliana E-value=0; Probable 3-hydroxyisobutyryl-CoA hydrolase 2 OS=Arabidopsis thaliana E-value=0; 3-hydroxyisobutyryl-CoA hydrolase-like protein 1, mitochondrial OS=Arabidopsis thaliana E-value=1e-80; 3-hydroxyisobutyryl-CoA hydrolase-like protein 2, mitochondrial OS=Arabidopsis thaliana E-value=4e-77; |
| Length | 1465 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS (2 ESTs); MT_HOGA (2 ESTs); MT_Drought (2 ESTs); MT_DSTEM2 (1 ESTs); MT_DSIL (1 ESTs); MT_SIRRA (1 ESTs); MT_JAS_ROOR (1 ESTs); MTFLOW (1 ESTs); MT_MGHG (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_NOD_NOLLY (1 ESTs); |
| Sequence | GTCCTTCCTCTCCCTCAGTCTTCTTCACCAACGACCATGGCATCCCCCGCCAAACTGGAT |
| EST members of Unigene | DY616090 AL384744 AL384743 AW688747 AW775527 BQ155250 CX531723 CB893626 CB065280 AJ497827 BE942762 BG450523 BE248006 EY478541 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K05605 3-hydroxyisobutyryl-CoA hydrolase; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K05605 3-hydroxyisobutyryl-CoA hydrolase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K05605 3-hydroxyisobutyryl-CoA hydrolase |
| EC | 3.1.2.4 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.10818.1.S1_at, Mtr.5322.1.S1_s_at
|
| Corresponding NCBI Gene | 836724 |
| Trichome-related Gene from Literature | N/A |