| Detail of EST/Unigene TCMT49598 |
| Acc. | TCMT49598 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Branched-chain-amino-acid aminotransferase 2, chloroplastic OS=Arabidopsis thaliana E-value=0; Branched-chain-amino-acid aminotransferase 1, mitochondrial OS=Arabidopsis thaliana E-value=0; Branched-chain-amino-acid aminotransferase 3, chloroplastic OS=Arabidopsis thaliana E-value=0; Branched-chain-amino-acid aminotransferase 5, chloroplastic OS=Arabidopsis thaliana E-value=0; Putative branched-chain-amino-acid aminotransferase 7 OS=Arabidopsis thaliana E-value=0; |
| Length | 1734 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_LEAF_PHOMA (6 ESTs); MT_JAS_ROOR (6 ESTs); MT_HOGA (3 ESTs); MT_MGHG (3 ESTs); MT_SEEDROOT_KV3 (3 ESTs); MT_KVKC (2 ESTs); MT_NOD_GVSN (2 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_ECELL (1 ESTs); MT_Drought (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_DLEAF (1 ESTs); MT_SROOT_KV0 (1 ESTs); |
| Sequence | ATATGTAAGTGTTCCAAGTGTTGTATAAAAAATTGCTACGTAGCAACCAAAATAACTATA |
| EST members of Unigene | CA921791 BF649975 DW018429 BE998673 BE998602 CB892082 CB891652 BG646103 BQ140729 BQ140227 BQ139991 BQ139292 BQ138647 BQ138445 BG452676 BE205359 CX534163 CX533363 CX532859 CX532534 CX531787 CX529059 CB894101 CB892775 BG647301 BQ165543 BQ165542 BE943318 BE940868 BE940853 BF635931 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00290 Valine, leucine and isoleucine biosynthesis > K00826 branched-chain amino acid aminotransferase; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K00826 branched-chain amino acid aminotransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00770 Pantothenate and CoA biosynthesis > K00826 branched-chain amino acid aminotransferase |
| EC | 2.6.1.42 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.43146.1.S1_at
|
| Corresponding NCBI Gene | 837543 |
| Trichome-related Gene from Literature | N/A |