Detail of EST/Unigene TCMT49972 |
Acc. | TCMT49972 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Bifunctional nitrilase/nitrile hydratase NIT4B OS=Nicotiana tabacum E-value=0; Bifunctional nitrilase/nitrile hydratase NIT4A OS=Nicotiana tabacum E-value=0; Bifunctional nitrilase/nitrile hydratase NIT4 OS=Arabidopsis thaliana E-value=0; Bifunctional nitrilase/nitrile hydratase NIT4 OS=Oryza sativa subsp. japonica E-value=0; Nitrilase 2 OS=Arabidopsis thaliana E-value=0; |
Length | 1416 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA (2 ESTs); MT_KVKC (2 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_Drought (1 ESTs); MT_ECELL (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_NOD_GVN (1 ESTs); MHRP-root (1 ESTs); MT_LEAF_PHOMA (1 ESTs); MT_DSIL (1 ESTs); MT_PhoLEAF (1 ESTs); |
Sequence | GAATACCTTCATCCCTGTAAATGAAGGAACTAGAAAGAAGTAAAAACACACTTGACTTCT |
EST members of Unigene | CA921978 BF646730 EV255968 DW017471 AW574053 BE240743 BQ141069 AW775480 BE324946 BG647336 BG646338 BQ165499 BQ165498 BF633874 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01431 beta-ureidopropionase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01431 beta-ureidopropionase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K01431 beta-ureidopropionase; Metabolism > Metabolism of Cofactors and Vitamins > ko00770 Pantothenate and CoA biosynthesis > K01431 beta-ureidopropionase |
EC | 3.5.1.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.2858.1.S1_at, Mtr.37782.1.S1_at
|
Corresponding NCBI Gene | 832290 |
Trichome-related Gene from Literature | N/A |