| Detail of EST/Unigene TCMT49972 |
| Acc. | TCMT49972 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Bifunctional nitrilase/nitrile hydratase NIT4B OS=Nicotiana tabacum E-value=0; Bifunctional nitrilase/nitrile hydratase NIT4A OS=Nicotiana tabacum E-value=0; Bifunctional nitrilase/nitrile hydratase NIT4 OS=Arabidopsis thaliana E-value=0; Bifunctional nitrilase/nitrile hydratase NIT4 OS=Oryza sativa subsp. japonica E-value=0; Nitrilase 2 OS=Arabidopsis thaliana E-value=0; |
| Length | 1416 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA (2 ESTs); MT_KVKC (2 ESTs); MHRP-root (1 ESTs); MT_LEAF_PHOMA (1 ESTs); MT_DSIL (1 ESTs); MT_PhoLEAF (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_Drought (1 ESTs); MT_ECELL (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_NOD_GVN (1 ESTs); |
| Sequence | GAATACCTTCATCCCTGTAAATGAAGGAACTAGAAAGAAGTAAAAACACACTTGACTTCT |
| EST members of Unigene | CA921978 BF646730 EV255968 DW017471 AW574053 BE240743 BQ141069 AW775480 BE324946 BG647336 BG646338 BQ165499 BQ165498 BF633874 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01431 beta-ureidopropionase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01431 beta-ureidopropionase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K01431 beta-ureidopropionase; Metabolism > Metabolism of Cofactors and Vitamins > ko00770 Pantothenate and CoA biosynthesis > K01431 beta-ureidopropionase |
| EC | 3.5.1.6 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.2858.1.S1_at, Mtr.37782.1.S1_at
|
| Corresponding NCBI Gene | 832290 |
| Trichome-related Gene from Literature | N/A |