Detail of EST/Unigene TCMT52645 |
Acc. | TCMT52645 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase parA OS=Nicotiana tabacum E-value=1e-80; Probable glutathione S-transferase parC OS=Nicotiana tabacum E-value=2e-74; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=8e-74; Glutathione S-transferase U25 OS=Arabidopsis thaliana E-value=1e-73; Probable glutathione S-transferase MSR-1 OS=Nicotiana plumbaginifolia E-value=2e-73; |
Length | 860 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR (12 ESTs); MT_ECELL (8 ESTs); MT_JCVI-MT2 (6 ESTs); MT_HOGA (3 ESTs); MTUS_MIXTISSUE (1 ESTs); MTAPHEU (1 ESTs); MT_DLEAF (1 ESTs); MT_KVKC (1 ESTs); MT_JCVI-MT3 (1 ESTs); |
Sequence | GGAATCATCTAACAATGCAATGAGTCAATACATGGATAAGGACAGTGTGGTTTTGTTGGA |
EST members of Unigene | CA920655 AJ548312 BG448292 BF648244 BF646236 BF646086 BF644916 BF644308 BF644078 BF643273 BG454770 CX534619 CX534365 CX533700 CX532384 CX531576 CX531398 CX530597 CX530060 CX529898 CX529882 CX529676 CX529137 BG649027 BG648594 BG646360 BQ165173 EY477171 GE351382 GE350205 GE350658 GE346900 GE345749 GE345229 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
Probeset |
Mtr.10502.1.S1_s_at
|
Corresponding NCBI Gene | 838289 |
Trichome-related Gene from Literature | N/A |