Detail of EST/Unigene TCMT52979 |
Acc. | TCMT52979 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-ureidopropionase OS=Homo sapiens E-value=2e-87; Beta-ureidopropionase OS=Pongo abelii E-value=2e-86; Beta-ureidopropionase OS=Rattus norvegicus E-value=4e-86; Beta-ureidopropionase OS=Mus musculus E-value=1e-85; Beta-ureidopropionase OS=Dictyostelium discoideum E-value=3e-85; |
Length | 1117 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots (3 ESTs); MT_ECELL (2 ESTs); MT_DLEAF (2 ESTs); MT_INSECT (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_DSLC (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MT_LEAF_PHOMA (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_PhoLEAF (1 ESTs); MtBB_NOD (1 ESTs); MT_SROOT_KV1 (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_Drought (1 ESTs); |
Sequence | CTCGTAATTTCAATATTATTTTTTACCAAATATCTCTTTACCTTTAGTCAATAGTATTGC |
EST members of Unigene | AL378412 AW560435 CX528145 CX525779 CX524306 BF650206 BF645291 DW018913 BF005990 AW736232 BQ139138 BG454927 BE318959 BE204064 BF638748 BF003652 BF634926 BI265648 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01431 beta-ureidopropionase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01431 beta-ureidopropionase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K01431 beta-ureidopropionase; Metabolism > Metabolism of Cofactors and Vitamins > ko00770 Pantothenate and CoA biosynthesis > K01431 beta-ureidopropionase |
EC | 3.5.1.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.8656.1.S1_s_at
|
Corresponding NCBI Gene | 836558 |
Trichome-related Gene from Literature | N/A |