Detail of EST/Unigene TCMT57170 |
Acc. | TCMT57170 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | GMP synthase [glutamine-hydrolyzing] OS=Aquifex aeolicus (strain VF5) E-value=1e-80; GMP synthase [glutamine-hydrolyzing] OS=Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1) E-value=2e-79; GMP synthase [glutamine-hydrolyzing] OS=Pelodictyon luteolum (strain DSM 273) E-value=7e-79; GMP synthase [glutamine-hydrolyzing] OS=Chlorobium tepidum (strain ATCC 49652 / DSM 12025 / TLS) E-value=7e-79; GMP synthase [glutamine-hydrolyzing] OS=Bradyrhizobium japonicum (strain USDA 110) E-value=2e-78; |
Length | 1059 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTGIM (2 ESTs); MT_JCVI-MT2 (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_DSIL (1 ESTs); |
Sequence | TTTTTTTTTGTAAAGTTATCTTTCGATCATTGAGGAGCAATTATAGTTCGATTCAATTGA |
EST members of Unigene | CF068349 AJ499762 AJ500879 BF521432 GE352060 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01951 GMP synthase (glutamine-hydrolysing); Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01951 GMP synthase (glutamine-hydrolysing); Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01951 GMP synthase (glutamine-hydrolysing) |
EC | 6.3.5.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.41931.1.S1_at
|
Corresponding NCBI Gene | 842670 |
Trichome-related Gene from Literature | N/A |