Detail of EST/Unigene TCMT58913 |
Acc. | TCMT58913 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ubiquitin-conjugating enzyme E2 34 OS=Arabidopsis thaliana E-value=2e-96; Probable ubiquitin-conjugating enzyme E2 33 OS=Arabidopsis thaliana E-value=2e-95; Ubiquitin-conjugating enzyme E2 J2 OS=Homo sapiens E-value=4e-46; Ubiquitin-conjugating enzyme E2 J2 OS=Mus musculus E-value=8e-46; Ubiquitin-conjugating enzyme E2 J2 OS=Bos taurus E-value=8e-46; |
Length | 1311 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR (3 ESTs); MT_Drought (3 ESTs); MT_DLEAF (3 ESTs); MT_DSIL (3 ESTs); MTUS_MIXTISSUE (2 ESTs); MT_PhoLEAF (2 ESTs); MtBB_NOD (2 ESTs); MT_Shoots (2 ESTs); MT_DSTEM2 (2 ESTs); MT_ECELL (2 ESTs); MT_JCVI-MT1 (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_FLOSEED_MTY (2 ESTs); MT_SIRRA (1 ESTs); MT_DROOT (1 ESTs); MT_VILEAF (1 ESTs); MT_INSECT (1 ESTs); MT_TRI (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MT_CDS (1 ESTs); |
Sequence | ATTTGTTTTCGCTGTTTCGTTTTCCAAAAAGGGGCNTAAATAATTAACCGCGGAAATTCA |
EST members of Unigene | BT053340 CA921925 CA921924 AL378187 AL378186 BE320464 CX524720 CX524697 AW692505 AW689945 BF646724 BF644623 EV262116 EV260682 DW018793 DW015551 BG645468 BG453711 BG452056 BE318990 BF520794 AW981293 AW776151 BE323251 BF638589 BI269368 CX522287 CX534557 CX534548 CX529571 BF636520 BF635592 BF632750 BI267824 GE346869 GE349309 EX527799 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K04554 ubiquitin-conjugating enzyme E2 J2 |
EC | 6.3.2.19 |
Transcription Factor Family | |
Transporter Classification Family | 3.A.2 H+- or Na+-translocating F-type, V-type and A-type ATPase superfamily F-ATPase |
Probeset |
Mtr.17569.1.S1_at
|
Corresponding NCBI Gene | 838300 |
Trichome-related Gene from Literature | N/A |