Detail of EST/Unigene TCMT59585 |
Acc. | TCMT59585 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Thermospermine synthase ACAULIS5 OS=Arabidopsis thaliana E-value=0; Probable spermidine synthase OS=Sulfolobus tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7) E-value=1e-54; Probable spermidine synthase OS=Sulfolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2) E-value=1e-54; Probable spermidine synthase OS=Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1) E-value=5e-53; Probable spermidine synthase OS=Sulfolobus islandicus (strain M.14.25 / Kamchatka #1) E-value=5e-53; |
Length | 1545 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV0 (2 ESTs); MTUS_MIXTISSUE (2 ESTs); MT_JCVI-MT1 (2 ESTs); MT_JCVI-MT3 (1 ESTs); MT_CDS (1 ESTs); MT_ROOTPHOS (1 ESTs); MT_LEAF_PHOMA (1 ESTs); |
Sequence | CCCCATAATCCACATTGCACTTTGCACCCACCATTGCCACTTGTTTCTTTTCGTTCTTTT |
EST members of Unigene | BT051905 CA920912 CA920142 EV257838 EV257581 AW288039 BQ137991 BE204451 BE204391 EY474007 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00797 spermidine synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00797 spermidine synthase |
EC | 2.5.1.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.10647.1.S1_at, Mtr.35388.1.S1_s_at
|
Corresponding NCBI Gene | 832073 |
Trichome-related Gene from Literature | N/A |