| Detail of EST/Unigene TCMT40096 |
| Acc. | TCMT40096 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Pleckstrin homology domain-containing protein 1 OS=Arabidopsis thaliana E-value=8e-56; PH domain-containing protein DDB_G0274775 OS=Dictyostelium discoideum E-value=2e-12; Cytohesin-3 OS=Mus musculus E-value=2e-11; Cytohesin-2 OS=Chlorocebus aethiops E-value=3e-10; Cytohesin-1 OS=Rattus norvegicus E-value=4e-10; |
| Length | 735 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED (3 ESTs); MTAMP (3 ESTs); MT_JCVI-MT2 (2 ESTs); MT_FLOSEED_MTY (2 ESTs); MT_NOD_ROOT (2 ESTs); MT_ROOTPHOS (2 ESTs); MtBC_GLOMUS (1 ESTs); MT_JCVI-MT1 (1 ESTs); MTPOSE (1 ESTs); |
| Sequence | GGGAATCCAGCAAAGCAATGCGATGCAACTTGTTTCCTTCATAGCAAACTGAGTTGTAAT |
| EST members of Unigene | AL388935 CX536634 CX536467 BI268718 EV260410 DW017331 DW016023 AW685159 AW684250 AW328985 AW328977 AJ503917 AJ503205 AJ502435 AJ498925 GE349345 GE344244 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04456 RAC serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04630 Jak-STAT signaling pathway > K04456 RAC serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04456 RAC serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04456 RAC serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04456 RAC serine/threonine-protein kinase |
| EC | 2.7.11.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.8829.1.S1_at
|
| Corresponding NCBI Gene | 830455 |
| Trichome-related Gene from Literature | N/A |