Detail of EST/Unigene TCMT40306 |
Acc. | TCMT40306 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S27-2 OS=Arabidopsis thaliana E-value=1e-36; 40S ribosomal protein S27 OS=Hordeum vulgare E-value=2e-35; 40S ribosomal protein S27-1 OS=Arabidopsis thaliana E-value=3e-34; 40S ribosomal protein S27-3 OS=Arabidopsis thaliana E-value=4e-34; 40S ribosomal protein S27 OS=Chlamydomonas reinhardtii E-value=2e-30; |
Length | 554 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2 (4 ESTs); MtBA (4 ESTs); MT_DSIL (3 ESTs); MT_GSEED (3 ESTs); MT_ROOTPHOS (2 ESTs); MT_MGHG (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_ECELL (1 ESTs); MHRP-root (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MT_DLEAF (1 ESTs); MT_NOD_NOLLY (1 ESTs); MT_PhoLEAF (1 ESTs); MtBC_GLOMUS (1 ESTs); MTFLOW (1 ESTs); MT_DROOT (1 ESTs); |
Sequence | CCTCAATCTATTTCCAGTATCTAGGGTTTACTTCTCATCACACATCCGAACGGCGCAAAA |
EST members of Unigene | DY617434 AL383828 AW687431 CX541046 CX538242 CX536620 AW560512 BF644351 AW329579 AW329815 BE239348 AW736010 BG453408 BF519619 BE123976 AW127391 BF638590 AJ497957 AL373373 AL373372 AL369027 AL369026 BE943214 GE351581 GE352658 GE348379 GE347143 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02978 small subunit ribosomal protein S27e |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.40296.1.S1_at
|
Corresponding NCBI Gene | 825283 |
Trichome-related Gene from Literature | N/A |