| Detail of EST/Unigene TCMT40306 |
| Acc. | TCMT40306 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S27-2 OS=Arabidopsis thaliana E-value=1e-36; 40S ribosomal protein S27 OS=Hordeum vulgare E-value=2e-35; 40S ribosomal protein S27-1 OS=Arabidopsis thaliana E-value=3e-34; 40S ribosomal protein S27-3 OS=Arabidopsis thaliana E-value=4e-34; 40S ribosomal protein S27 OS=Chlamydomonas reinhardtii E-value=2e-30; |
| Length | 554 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBA (4 ESTs); MT_JCVI-MT2 (4 ESTs); MT_DSIL (3 ESTs); MT_GSEED (3 ESTs); MT_ROOTPHOS (2 ESTs); MHRP-root (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MT_DLEAF (1 ESTs); MT_NOD_NOLLY (1 ESTs); MT_PhoLEAF (1 ESTs); MtBC_GLOMUS (1 ESTs); MTFLOW (1 ESTs); MT_DROOT (1 ESTs); MT_MGHG (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_ECELL (1 ESTs); |
| Sequence | CCTCAATCTATTTCCAGTATCTAGGGTTTACTTCTCATCACACATCCGAACGGCGCAAAA |
| EST members of Unigene | DY617434 AL383828 AW687431 CX541046 CX538242 CX536620 AW560512 BF644351 AW329579 AW329815 BE239348 AW736010 BG453408 BF519619 BE123976 AW127391 BF638590 AJ497957 AL373373 AL373372 AL369027 AL369026 BE943214 GE351581 GE352658 GE348379 GE347143 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02978 small subunit ribosomal protein S27e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.40296.1.S1_at
|
| Corresponding NCBI Gene | 825283 |
| Trichome-related Gene from Literature | N/A |