| Detail of EST/Unigene TCMT40329 |
| Acc. | TCMT40329 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S15a-1 OS=Arabidopsis thaliana E-value=1e-68; 40S ribosomal protein S15a OS=Brassica napus E-value=3e-68; 40S ribosomal protein S15a OS=Daucus carota E-value=1e-67; 40S ribosomal protein S15a-4 OS=Arabidopsis thaliana E-value=1e-67; 40S ribosomal protein S15a-3 OS=Arabidopsis thaliana E-value=2e-63; |
| Length | 807 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA (8 ESTs); MT_JCVI-MT2 (8 ESTs); MT_PhoLEAF (6 ESTs); MT_Drought (4 ESTs); MtBC_GLOMUS (3 ESTs); MT_JAS_ROOR (3 ESTs); MT_GSEED (3 ESTs); MT_ECELL (3 ESTs); MT_DLEAF (3 ESTs); MT_NOD_ROOT (2 ESTs); MT_DFLOWER (2 ESTs); MT_NOD_NOLLY (1 ESTs); MT_HOGA (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_INSECT (1 ESTs); MT_DSLC (1 ESTs); MT_TRI (1 ESTs); MT_DSIL (1 ESTs); |
| Sequence | CTGATTCGCCAGCTCGAAATTAACCCTCCTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
| EST members of Unigene | DY616979 AL385410 AL385409 AL382209 CX537873 CX536631 BI268648 BQ136677 BQ135734 BF646786 DW018445 BF004971 BG448698 AW685589 BQ149041 BI272948 BG452778 AW682989 BF637079 AW127360 BQ158586 BQ158584 BQ158510 BQ158219 BQ158161 BF638222 BQ157454 BQ156528 BQ155708 BQ155373 BQ154092 BQ153347 BQ152736 BQ151929 CX533396 CX530277 CX529058 BG647931 BQ144961 BQ144652 BQ144623 BG451840 BQ142253 GE351120 GE351148 GE349563 GE344492 GE346470 GE346469 GE346410 GE346409 EX526709 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02957 small subunit ribosomal protein S15Ae |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1801.1.S1_at, Mtr.40261.1.S1_at, Mtr.40261.1.S1_s_at
|
| Corresponding NCBI Gene | 836107 |
| Trichome-related Gene from Literature | N/A |