| Detail of EST/Unigene TCMT40871 |
| Acc. | TCMT40871 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S26-3 OS=Arabidopsis thaliana E-value=1e-31; 40S ribosomal protein S26-2 OS=Arabidopsis thaliana E-value=4e-31; 40S ribosomal protein S26-1 OS=Arabidopsis thaliana E-value=4e-31; 40S ribosomal protein S26 OS=Oryza sativa subsp. japonica E-value=5e-30; 40S ribosomal protein S26 OS=Caenorhabditis elegans E-value=1e-24; |
| Length | 690 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD (13 ESTs); MT_PhoLEAF (6 ESTs); MT_VILEAF (2 ESTs); MT_JCVI-MT3 (2 ESTs); MT_NOD_ROOT (2 ESTs); GLSD (2 ESTs); MT_SIRRA (1 ESTs); MtBC_GLOMUS (1 ESTs); MT_SROOT_KV1 (1 ESTs); MtBA (1 ESTs); MT_DROOT (1 ESTs); MT_MGHG (1 ESTs); MT_GSEED (1 ESTs); MT_INSECT (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_JCVI-MT2 (1 ESTs); MT_DFLOWER (1 ESTs); MT_TRI (1 ESTs); |
| Sequence | CATAACCCTAGCTGCCGCGAACGAGCGAAGAAGACAGCAAAACCTTGGAGAGCTTCAACA |
| EST members of Unigene | AL385393 AL381187 AL381186 AL380210 AL380209 AL377141 AL377140 AL376916 AL376915 AL376130 AL376129 AL374135 AL373757 AL373756 AW687370 CX539836 DW018456 AW686424 AW684830 BI271818 BQ123030 BQ123026 BI264547 BE323627 BE323068 BE324502 BE323833 BF638553 BI269919 CX520448 CX517600 BE202550 AL368722 BE942981 BG449756 EY477780 EY474087 GE345333 ES611025 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02976 small subunit ribosomal protein S26e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.40213.1.S1_at
|
| Corresponding NCBI Gene | 824801 |
| Trichome-related Gene from Literature | N/A |