Detail of EST/Unigene TCMT41197 |
Acc. | TCMT41197 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 6-phosphofructokinase 3 OS=Arabidopsis thaliana E-value=0; 6-phosphofructokinase 7 OS=Arabidopsis thaliana E-value=0; 6-phosphofructokinase 1 OS=Arabidopsis thaliana E-value=0; 6-phosphofructokinase 6 OS=Arabidopsis thaliana E-value=0; 6-phosphofructokinase 4, chloroplastic OS=Arabidopsis thaliana E-value=0; |
Length | 1927 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL (5 ESTs); MT_SROOT_KV1 (2 ESTs); MT_NOD_GVN (2 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_LEAF_PHOMA (1 ESTs); MT_DROOT (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_Shoots (1 ESTs); MT_SIRRA (1 ESTs); MT_DSTEM2 (1 ESTs); MT_MGHG (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_Drought (1 ESTs); MT_NOD_ROOT (1 ESTs); MTAMP (1 ESTs); MHRP-root (1 ESTs); |
Sequence | TCAACTATATAATCTACTACTTGCTTAAACTTATTCTTATATAGCTTTTTCATTGCTTGA |
EST members of Unigene | CA921659 BE320358 CX526402 AW690267 BF647306 BF646399 BF644729 BF643910 BF643375 EV257956 BG580815 AW574026 AW686722 AJ501551 BG588206 BG645133 BQ139811 BE204667 BQ157276 BF003382 BE203471 BE942354 BF631892 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00850 6-phosphofructokinase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00850 6-phosphofructokinase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00850 6-phosphofructokinase; Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K00850 6-phosphofructokinase |
EC | 2.7.1.11 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.48868.1.S1_at
|
Corresponding NCBI Gene | 828733 |
Trichome-related Gene from Literature | N/A |