Detail of EST/Unigene TCMT41346 |
Acc. | TCMT41346 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--glyoxylate aminotransferase 2 OS=Arabidopsis thaliana E-value=0; Glutamate--glyoxylate aminotransferase 1 OS=Arabidopsis thaliana E-value=0; Probable alanine aminotransferase, mitochondrial OS=Dictyostelium discoideum E-value=0; Alanine aminotransferase 2 OS=Panicum miliaceum E-value=0; Alanine aminotransferase 2 OS=Hordeum vulgare E-value=0; |
Length | 1472 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF (11 ESTs); MT_SROOT_KV2 (4 ESTs); MT_DFLOWER (3 ESTs); MT_DSIL (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_Shoots (2 ESTs); MtBA (1 ESTs); MT_Drought (1 ESTs); MT_INSECT (1 ESTs); MT_GSEED (1 ESTs); MT_BML (1 ESTs); MT_NOD_GVN (1 ESTs); MT_DSLC (1 ESTs); |
Sequence | GTTCTACTTGATGATCCTAATGTCGGACTGCTATTCCCTGCTGATGCAATTGCAAGAGCT |
EST members of Unigene | CX541043 CX528469 CX525757 BG581475 BF006199 BQ148659 BQ146396 BI270744 BF520362 AW127372 BM780098 BM780025 BM779841 BM779723 CX522223 CX521268 CX520936 CX520600 CX519917 CX519350 CX519234 CX517964 CX517153 CX516712 CX516645 AL368647 BF633488 BG449893 GE349159 GE344039 GD185724 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K00814 alanine transaminase |
EC | 2.6.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.22060.1.S1_at
|
Corresponding NCBI Gene | 843395 |
Trichome-related Gene from Literature | N/A |