Detail of EST/Unigene TCMT41937 |
Acc. | TCMT41937 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 60S ribosomal protein L31 OS=Nicotiana glutinosa E-value=5e-43; 60S ribosomal protein L31 OS=Perilla frutescens E-value=8e-43; 60S ribosomal protein L31 OS=Panax ginseng E-value=3e-42; 60S ribosomal protein L31-3 OS=Arabidopsis thaliana E-value=4e-41; 60S ribosomal protein L31-2 OS=Arabidopsis thaliana E-value=1e-40; |
Length | 775 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (7 ESTs); MT_JCVI-MT2 (6 ESTs); MtBB_NOD (5 ESTs); MT_GSEED (4 ESTs); MT_DFLOWER (3 ESTs); MT_JCVI-MT1 (2 ESTs); MT_ROOTPHOS (2 ESTs); MT_VILEAF (1 ESTs); MT_SROOT_KV1 (1 ESTs); MT_DSTEM2 (1 ESTs); MT_MGHG (1 ESTs); MT_ECELL (1 ESTs); MT_Drought (1 ESTs); MT_NOD_GVN (1 ESTs); MT_TRI (1 ESTs); MT_GESD (1 ESTs); MT_CDS (1 ESTs); MT_DLEAF (1 ESTs); MT_PhoLEAF (1 ESTs); |
Sequence | CTGATTCGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGC |
EST members of Unigene | BT051229 AL389784 AL389639 AL389638 AL389188 AL389187 AL382424 AL382423 AL379290 AL379289 AL378086 AL376888 AL376887 CX542026 CX539097 CX537925 BQ145640 BE326001 BF646868 EV258404 EV255441 BG580725 AW329484 AW329266 BI310638 BQ148151 BI273348 BI272101 BQ150965 BF638134 CX520104 BF003780 BE941233 BG451525 GE350046 GE352793 GE352125 GE347770 GE348534 GE345045 EX532784 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02910 large subunit ribosomal protein L31e |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37558.1.S1_at
|
Corresponding NCBI Gene | 835772 |
Trichome-related Gene from Literature | N/A |