Detail of EST/Unigene TCMT42252 |
Acc. | TCMT42252 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem II reaction center W protein, chloroplastic OS=Spinacia oleracea E-value=5e-17; Photosystem II reaction center W protein, chloroplastic OS=Arabidopsis thaliana E-value=2e-12; Photosystem II reaction center W protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-06; |
Length | 698 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA (11 ESTs); MT_VILEAF (7 ESTs); MT_DLEAF (5 ESTs); MT_JCVI-MT2 (5 ESTs); MT_Drought (4 ESTs); MT_DSLC (3 ESTs); MT_GSEED (2 ESTs); MT_PhoLEAF (2 ESTs); MT_JCVI-MT1 (1 ESTs); MT_DSIL (1 ESTs); MT_CDS (1 ESTs); MTUS_MIXTISSUE (1 ESTs); |
Sequence | GTGCACCAATTCTAATAACTAATATTACAACATATTTGCCCATTTGTCTGAAATAAGCAA |
EST members of Unigene | BT051487 CA923000 CX542231 CX542195 EV258621 BF005807 BF005642 BF005448 BG454735 BG452495 BE317044 BE317033 AW682892 AW981467 BG456566 BE324644 BQ157231 BQ156679 BQ156582 BQ155196 BQ154982 BQ153092 BQ153071 BQ152516 BI269721 BI269668 BI269573 CX523562 CX520479 CX519787 CX519354 CX518583 CX518014 CX516877 BG450781 BF635736 BF635545 BF635109 GE350822 GE348550 GE346219 GE346218 GE345931 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.8609.1.S1_at
|
Corresponding NCBI Gene | 817606 |
Trichome-related Gene from Literature | N/A |