Detail of EST/Unigene TCMT42294 |
Acc. | TCMT42294 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 60S ribosomal protein L32-1 OS=Arabidopsis thaliana E-value=1e-56; 60S ribosomal protein L32-2 OS=Arabidopsis thaliana E-value=6e-56; 60S ribosomal protein L32 OS=Spodoptera frugiperda E-value=2e-40; 60S ribosomal protein L32 OS=Rattus norvegicus E-value=5e-40; 60S ribosomal protein L32 OS=Sus scrofa E-value=5e-40; |
Length | 663 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD (6 ESTs); MT_VILEAF (4 ESTs); MtBC_GLOMUS (4 ESTs); MT_GSEED (3 ESTs); MTFLOW (2 ESTs); MT_ROOTPHOS (2 ESTs); MT_DFLOWER (2 ESTs); MT_NOD_NOLLY (2 ESTs); MT_JAS_ROOR (2 ESTs); MT_SROOT_KV1 (1 ESTs); MT_TRI (1 ESTs); MTAMP (1 ESTs); MHRP-root (1 ESTs); MT_LEAF_PHOMA (1 ESTs); MT_DLEAF (1 ESTs); MT_PhoLEAF (1 ESTs); |
Sequence | GTTACATCTCTCAGAAAGAAAGAAAACTGCGCATTGTTCAACCAGGTAAGGTAAGATGGC |
EST members of Unigene | DY615880 DY615819 AL386595 AL386594 AL383318 AL383317 AL378267 AL378266 AL378176 AL378175 AL376505 AL376504 CX542144 CX536688 BQ145696 AW328848 AW171735 AJ504155 BG589159 BQ148329 BQ147248 BQ138488 AW683655 BG458195 CX523554 CX520625 CX517733 CX516851 CX531320 CX530355 BF004122 AJ497783 AJ497353 EX530717 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02912 large subunit ribosomal protein L32e |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.3114.1.S1_at, Mtr.40197.1.S1_at
|
Corresponding NCBI Gene | 827535 |
Trichome-related Gene from Literature | N/A |