| Detail of EST/Unigene TCMT42746 |
| Acc. | TCMT42746 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Subtilisin inhibitor CLSI-II OS=Canavalia lineata E-value=1e-30; Kunitz-type trypsin inhibitor-like 2 protein OS=Pisum sativum E-value=3e-30; Kunitz-type trypsin inhibitor-like 1 protein OS=Pisum sativum E-value=2e-29; Kunitz-type serine protease inhibitor DrTI OS=Delonix regia E-value=2e-26; Trypsin inhibitor DE-3 OS=Erythrina latissima E-value=3e-14; |
| Length | 807 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL (22 ESTs); MT_MGHG (10 ESTs); MT_JAS_ROOR (8 ESTs); MT_SIRRA (5 ESTs); MT_DLEAF (4 ESTs); MtBC_GLOMUS (3 ESTs); MT_JCVI-MT2 (2 ESTs); MT_TRI (2 ESTs); MTAMP (2 ESTs); MHRP-root (1 ESTs); MT_LEAF_PHOMA (1 ESTs); MT_Drought (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_JCVI-MT1 (1 ESTs); |
| Sequence | GGACAAAACAAACACACACATCTATCATTGAAACTTCACAAACCATGAAATCAACATTAT |
| EST members of Unigene | AL387545 AL387544 AL386987 AW207979 BQ135920 BI262857 BG448038 BG447794 BF650610 BF649673 BF649446 BF649328 BF648116 BF647608 BF647076 BF646853 BF646787 BF646143 BF646082 BF645902 BF645768 BF645309 BF645113 BF644366 BF644323 BF643660 EV257874 AJ501631 AJ501486 BG589073 BQ138886 BG454848 BG453541 BG452203 BG452134 BQ157642 BQ157173 BQ157005 BQ155019 BQ153202 CX533292 CX533187 CX531735 CX530965 CX530630 CX530233 CX530114 CX529569 BE943386 BE943383 BE943242 BE942684 BE942672 BE941945 BE941610 BE941474 BE941470 BE940929 BF631721 EY476934 GE350275 GE345306 EX531572 EX526285 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.10438.1.S1_at
|
| Corresponding NCBI Gene | 843660 |
| Trichome-related Gene from Literature | N/A |