Detail of EST/Unigene TCMT43315 |
Acc. | TCMT43315 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 14 kDa proline-rich protein DC2.15 OS=Daucus carota E-value=2e-17; Putative lipid-binding protein At4g00165 OS=Arabidopsis thaliana E-value=9e-09; 36.4 kDa proline-rich protein OS=Solanum lycopersicum E-value=1e-08; Cortical cell-delineating protein OS=Zea mays E-value=1e-08; |
Length | 871 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD (15 ESTs); MtBC_GLOMUS (4 ESTs); MT_NOD_GVN (3 ESTs); MT_JCVI-MT2 (2 ESTs); MT_NOD_NOLLY (2 ESTs); MT_GSEED (2 ESTs); MT_ROOTPHOS (1 ESTs); MT_SROOT_KV2 (1 ESTs); MT_SROOT_KV1 (1 ESTs); MT_MGHG (1 ESTs); MT_JCVI-MT3 (1 ESTs); |
Sequence | GGACACTCTCCTCTCTTAACCTCTAGTAGCTTACTAGTATTTGCAATATACAATACTAGC |
EST members of Unigene | DY618062 DY617396 AL384752 AL384751 AL382605 AL381874 AL380970 AL380468 AL380467 AL379755 AL379754 AL378839 AL378838 AL378205 AL378204 AL377745 AL377744 AL376356 AL376176 AL376175 AL374040 CX536342 BI268653 BG581384 BG580729 BG580080 AW287985 AW257148 BF004416 BE942093 EY474438 GE349410 GE344317 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.40136.1.S1_at
|
Corresponding NCBI Gene | 826863 |
Trichome-related Gene from Literature | N/A |